Transcript: Human NR_160708.1

Homo sapiens uncharacterized LOC105369201 (LOC105369201), transcript variant 7, long non-coding RNA.

Source:
NCBI, updated 2019-01-31
Taxon:
Homo sapiens (human)
Gene:
LOC105369201 (105369201)
Length:
1282
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160708.1
NBCI Gene record:
LOC105369201 (105369201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13229 pDONR223 100% 17.5% None 0_1ins208;49A>G;264_1282del n/a
2 ccsbBroad304_13229 pLX_304 0% 17.5% V5 0_1ins208;49A>G;264_1282del n/a
3 TRCN0000477004 ACAAACGTTAACATACGGCACACT pLX_317 78.1% 17.5% V5 0_1ins208;49A>G;264_1282del n/a
Download CSV