Transcript: Human NR_163592.1

Homo sapiens carbamoyl-phosphate synthase 1 (CPS1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
CPS1 (1373)
Length:
4781
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163592.1
NBCI Gene record:
CPS1 (1373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045446 CGTACTTCAATCAATGTTGTT pLKO.1 1200 3UTR 100% 4.950 6.930 N CPS1 n/a
2 TRCN0000045444 CCAGAAATTAAGAACGTCGTA pLKO.1 1398 3UTR 100% 2.640 3.696 N CPS1 n/a
3 TRCN0000045445 GCTTTGGTGAAGGTATTCATA pLKO.1 3166 3UTR 100% 5.625 4.500 N CPS1 n/a
4 TRCN0000428716 GAACAGCCAGATGGGTTAATT pLKO_005 651 3UTR 100% 15.000 10.500 N CPS1 n/a
5 TRCN0000431846 GGTCCATTCAACGTCCAATTT pLKO_005 2868 3UTR 100% 13.200 9.240 N CPS1 n/a
6 TRCN0000045447 GCTCAAGGAATATGGTGTGAA pLKO.1 731 3UTR 100% 4.950 3.465 N CPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.