Transcript: Human NR_163920.1

Homo sapiens coiled-coil-helix-coiled-coil-helix domain containing 5 (CHCHD5), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-12
Taxon:
Homo sapiens (human)
Gene:
CHCHD5 (84269)
Length:
532
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163920.1
NBCI Gene record:
CHCHD5 (84269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242820 GCGGGACTGTCACTACCTTAA pLKO_005 131 3UTR 100% 10.800 15.120 N CHCHD5 n/a
2 TRCN0000257172 GGGCAACTGTGCAGAGCATAT pLKO_005 276 3UTR 100% 10.800 7.560 N CHCHD5 n/a
3 TRCN0000242823 ACTACCTTAAGATGAGCATTG pLKO_005 142 3UTR 100% 6.000 4.200 N CHCHD5 n/a
4 TRCN0000242821 CGAGGAGTGTCTTCGACAGAA pLKO_005 243 3UTR 100% 4.950 3.465 N CHCHD5 n/a
5 TRCN0000242822 TTTGAGGCCTTCGAGGAGTGT pLKO_005 232 3UTR 100% 2.640 1.584 N CHCHD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04352 pDONR223 100% 61.8% None (many diffs) n/a
2 ccsbBroad304_04352 pLX_304 0% 61.8% V5 (many diffs) n/a
3 TRCN0000470470 CCCGAATCGCAACTCCATCCGTGA pLX_317 100% 61.8% V5 (many diffs) n/a
Download CSV