Transcript: Human NR_164128.1

Homo sapiens coiled-coil domain containing 144 family, N-terminal like (CCDC144NL), non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CCDC144NL (339184)
Length:
2829
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164128.1
NBCI Gene record:
CCDC144NL (339184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183793 CCCTCTTTGATTCCTAGTATT pLKO.1 871 3UTR 100% 13.200 18.480 N CCDC144NL n/a
2 TRCN0000180870 GCCTGGAGAGTATTGTCATCT pLKO.1 707 3UTR 100% 4.950 6.930 N CCDC144NL n/a
3 TRCN0000149634 GCCCTCTTTGATTCCTAGTAT pLKO.1 870 3UTR 100% 5.625 3.938 N CCDC144NL n/a
4 TRCN0000147913 GCTCCCTTTAAGATTCAGTAA pLKO.1 1249 3UTR 100% 4.950 3.465 N CCDC144NL n/a
5 TRCN0000141027 CACCTGAAAGTCTTCCTCAAA pLKO.1 526 3UTR 100% 4.950 2.475 Y CCDC144B n/a
6 TRCN0000147095 CAGCAACTAGTTCCTGAATAT pLKO.1 492 3UTR 100% 0.000 0.000 Y CCDC144NL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05448 pDONR223 100% 23.4% None 1_143del;740G>A;807_2829del n/a
2 ccsbBroad304_05448 pLX_304 0% 23.4% V5 1_143del;740G>A;807_2829del n/a
Download CSV