Transcript: Mouse NM_013601.2

Mus musculus msh homeobox 2 (Msx2), mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Mus musculus (mouse)
Gene:
Msx2 (17702)
Length:
2162
CDS:
71..874

Additional Resources:

NCBI RefSeq record:
NM_013601.2
NBCI Gene record:
Msx2 (17702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070637 GAAACACAAGACCAACCGGAA pLKO.1 481 CDS 100% 2.160 3.024 N Msx2 n/a
2 TRCN0000435115 CACTTGATACAGAGTGAATTT pLKO_005 1002 3UTR 100% 13.200 9.240 N Msx2 n/a
3 TRCN0000070636 CCCTGCAAGCAGCATCCATAT pLKO.1 756 CDS 100% 10.800 7.560 N Msx2 n/a
4 TRCN0000436146 GATATTGTGTTAAGTCCATTT pLKO_005 1245 3UTR 100% 10.800 7.560 N Msx2 n/a
5 TRCN0000070634 CAGAAACAGTACCTGTCCATA pLKO.1 557 CDS 100% 4.950 3.465 N Msx2 n/a
6 TRCN0000413883 TCTAGCCTTGGAGCGCAAGTT pLKO_005 532 CDS 100% 4.950 3.465 N Msx2 n/a
7 TRCN0000070633 CCTGAGGAAACACAAGACCAA pLKO.1 475 CDS 100% 2.640 1.848 N Msx2 n/a
8 TRCN0000020435 CTGAGGAAACACAAGACCAAT pLKO.1 476 CDS 100% 4.950 2.970 N MSX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013601.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06597 pDONR223 100% 87.8% 92.1% None (many diffs) n/a
2 ccsbBroad304_06597 pLX_304 0% 87.8% 92.1% V5 (many diffs) n/a
3 TRCN0000471846 ACTTCCCCTTAACCTATTTACGTA pLX_317 61.6% 87.8% 92.1% V5 (many diffs) n/a
Download CSV