Transcript: Mouse NM_026042.3

Mus musculus mediator complex subunit 29 (Med29), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Med29 (67224)
Length:
2162
CDS:
28..627

Additional Resources:

NCBI RefSeq record:
NM_026042.3
NBCI Gene record:
Med29 (67224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297563 TTCCCACTGGGCCGATGATTA pLKO_005 829 3UTR 100% 13.200 10.560 N Med29 n/a
2 TRCN0000191677 GATCGTATTATACAAGAGGAA pLKO.1 1022 3UTR 100% 2.640 2.112 N Med29 n/a
3 TRCN0000278833 AGTACCTGGCTGTCATCAAAG pLKO_005 500 CDS 100% 10.800 7.560 N Med29 n/a
4 TRCN0000297562 CTGTGCCAAAGACATTCATAC pLKO_005 531 CDS 100% 10.800 7.560 N Med29 n/a
5 TRCN0000278777 TGATTCAGAACACTAACATTG pLKO_005 269 CDS 100% 10.800 7.560 N Med29 n/a
6 TRCN0000201589 CCCAGTGTATGGATTTCCTTT pLKO.1 929 3UTR 100% 4.950 3.465 N Med29 n/a
7 TRCN0000202465 GCAGCGCTTTGACAAGTGTTT pLKO.1 321 CDS 100% 4.950 3.465 N Med29 n/a
8 TRCN0000278832 GCAGCGCTTTGACAAGTGTTT pLKO_005 321 CDS 100% 4.950 3.465 N Med29 n/a
9 TRCN0000202252 GCCACAGTAATGCAGCTGAAA pLKO.1 703 3UTR 100% 4.950 3.465 N Med29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12227 pDONR223 100% 84.9% 92% None (many diffs) n/a
2 ccsbBroad304_12227 pLX_304 0% 84.9% 92% V5 (many diffs) n/a
Download CSV