Transcript: Human NM_001290265.1

Homo sapiens ceramide synthase 1 (CERS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CERS1 (10715)
Length:
1983
CDS:
213..932

Additional Resources:

NCBI RefSeq record:
NM_001290265.1
NBCI Gene record:
CERS1 (10715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167819 GTTCACCAAGCTCAACATTTA pLKO.1 569 CDS 100% 13.200 6.600 Y CERS1 n/a
2 TRCN0000168362 GAGTTCACCAAGCTCAACATT pLKO.1 567 CDS 100% 5.625 2.813 Y CERS1 n/a
3 TRCN0000139300 CCCTTATGAACCTCTACTGGT pLKO.1 793 CDS 100% 2.640 1.320 Y CERS1 n/a
4 TRCN0000168046 CCTTATGAACCTCTACTGGTT pLKO.1 794 CDS 100% 2.640 1.320 Y CERS1 n/a
5 TRCN0000168211 CTACTTCTTCTTCAATGCGCT pLKO.1 758 CDS 100% 0.660 0.330 Y CERS1 n/a
6 TRCN0000140139 GCTTGAGTTCACCAAGCTCAA pLKO.1 563 CDS 100% 0.405 0.203 Y CERS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11541 pDONR223 100% 100% 100% None n/a
Download CSV