Transcript: Mouse XM_011244451.1

PREDICTED: Mus musculus ring finger protein 44 (Rnf44), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf44 (105239)
Length:
3939
CDS:
537..1589

Additional Resources:

NCBI RefSeq record:
XM_011244451.1
NBCI Gene record:
Rnf44 (105239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415416 AGAGCCCGTTCATGGTTGATC pLKO_005 559 CDS 100% 4.950 6.930 N RNF44 n/a
2 TRCN0000040548 CCTACCCTACTTCCTTTCAAT pLKO.1 1202 CDS 100% 5.625 3.938 N Rnf44 n/a
3 TRCN0000040549 TGTGCCATATTCCCACATGAT pLKO.1 1091 CDS 100% 4.950 3.465 N Rnf44 n/a
4 TRCN0000040550 CTTCCTTTCAATGCTGCCAAT pLKO.1 1211 CDS 100% 4.050 2.835 N Rnf44 n/a
5 TRCN0000040552 CCAAGTGTGTTGACAAGTGGT pLKO.1 1501 CDS 100% 2.640 1.848 N Rnf44 n/a
6 TRCN0000040551 CTGGATAACGAGATGGACCTT pLKO.1 945 CDS 100% 2.640 1.848 N Rnf44 n/a
7 TRCN0000432124 TCATCTCCAGTGACCACTACA pLKO_005 817 CDS 100% 4.950 2.970 N RNF44 n/a
8 TRCN0000429877 TCCTTTGGTGTGCCATATTCT pLKO_005 1083 CDS 100% 5.625 3.938 N RNF44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07807 pDONR223 100% 73.3% 77.7% None (many diffs) n/a
Download CSV