Transcript: Human XM_005261790.3

PREDICTED: Homo sapiens shisa like 1 (SHISAL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHISAL1 (85352)
Length:
6851
CDS:
232..831

Additional Resources:

NCBI RefSeq record:
XM_005261790.3
NBCI Gene record:
SHISAL1 (85352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263375 ATAACAACACGGTCTTCAAAT pLKO_005 416 CDS 100% 13.200 18.480 N SHISAL1 n/a
2 TRCN0000263376 TCACGACACTGTCCCATAAAT pLKO_005 6116 3UTR 100% 15.000 12.000 N SHISAL1 n/a
3 TRCN0000263377 AGGGTTACATGCACAACAATT pLKO_005 497 CDS 100% 13.200 9.240 N SHISAL1 n/a
4 TRCN0000282589 GCAGTCTTGTCTGCACATTTC pLKO_005 295 CDS 100% 10.800 7.560 N SHISAL1 n/a
5 TRCN0000282591 TGTTGGGAGTGTGGATCTATG pLKO_005 527 CDS 100% 10.800 7.560 N SHISAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09256 pDONR223 100% 99.8% 100% None 295T>C n/a
2 ccsbBroad304_09256 pLX_304 0% 99.8% 100% V5 295T>C n/a
3 TRCN0000480661 GACCCTTAATATATATCCAAGGTG pLX_317 69.3% 99.8% 100% V5 295T>C n/a
Download CSV