Transcript: Human XM_011537863.2

PREDICTED: Homo sapiens IQ motif containing D (IQCD), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQCD (115811)
Length:
2044
CDS:
561..1910

Additional Resources:

NCBI RefSeq record:
XM_011537863.2
NBCI Gene record:
IQCD (115811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435946 CAAGAACGTCCTTAGACTCTT pLKO_005 1016 CDS 100% 4.950 6.930 N IQCD n/a
2 TRCN0000431672 CTGATAGAGCTCCGTGGTTTC pLKO_005 1119 CDS 100% 6.000 4.800 N IQCD n/a
3 TRCN0000425573 GCATCCAACAGAGAGGATATG pLKO_005 777 CDS 100% 10.800 7.560 N IQCD n/a
4 TRCN0000412263 TGGTGACCTTGCTGTCGTATG pLKO_005 754 CDS 100% 6.000 4.200 N IQCD n/a
5 TRCN0000005036 CCACTTATGCAGCAGATCAAA pLKO.1 987 CDS 100% 5.625 3.938 N IQCD n/a
6 TRCN0000005035 CGGGAGATCAACTCCAAGAAA pLKO.1 1707 CDS 100% 5.625 3.938 N IQCD n/a
7 TRCN0000005037 GCCAAAGACAGACCCATCTAA pLKO.1 623 CDS 100% 5.625 3.938 N IQCD n/a
8 TRCN0000005038 CCTGCTCAGATCCAAGAAGAA pLKO.1 1814 CDS 100% 4.950 3.465 N IQCD n/a
9 TRCN0000005039 CCATCAACAGAATAGGGCCAA pLKO.1 607 CDS 100% 2.160 1.512 N IQCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04687 pDONR223 100% 77.2% 77.2% None 728_1033del n/a
2 ccsbBroad304_04687 pLX_304 0% 77.2% 77.2% V5 728_1033del n/a
Download CSV