Transcript: Human XM_017028105.1

PREDICTED: Homo sapiens minichromosome maintenance 8 homologous recombination repair factor (MCM8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCM8 (84515)
Length:
9599
CDS:
407..3049

Additional Resources:

NCBI RefSeq record:
XM_017028105.1
NBCI Gene record:
MCM8 (84515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285482 GGATCGATTCATACCATATAA pLKO_005 613 CDS 100% 15.000 21.000 N MCM8 n/a
2 TRCN0000020277 CGGGAGACACAGTGACTATTA pLKO.1 1380 CDS 100% 13.200 18.480 N MCM8 n/a
3 TRCN0000276010 CGGGAGACACAGTGACTATTA pLKO_005 1380 CDS 100% 13.200 18.480 N MCM8 n/a
4 TRCN0000020274 GCAAAGTATTAGTCTTGCTAA pLKO.1 2134 CDS 100% 4.950 6.930 N MCM8 n/a
5 TRCN0000020278 GCTCGTATGAATAGTCAAGAT pLKO.1 2402 CDS 100% 4.950 6.930 N MCM8 n/a
6 TRCN0000276011 GCTCGTATGAATAGTCAAGAT pLKO_005 2402 CDS 100% 4.950 6.930 N MCM8 n/a
7 TRCN0000276064 TTAGGGCCTCCTGGGTTTATT pLKO_005 3065 3UTR 100% 15.000 10.500 N MCM8 n/a
8 TRCN0000020275 GCTGAGGATATAGTGGAAATT pLKO.1 2735 CDS 100% 13.200 9.240 N MCM8 n/a
9 TRCN0000020276 CCTTTGATTGAGAAGATTCAA pLKO.1 677 CDS 100% 5.625 3.938 N MCM8 n/a
10 TRCN0000276065 CCTTTGATTGAGAAGATTCAA pLKO_005 677 CDS 100% 5.625 3.938 N MCM8 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 8904 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 8904 3UTR 100% 10.800 5.400 Y CD3EAP n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3138 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09195 pDONR223 100% 95% 94.6% None (many diffs) n/a
2 ccsbBroad304_09195 pLX_304 0% 95% 94.6% V5 (many diffs) n/a
Download CSV