Transcript: Human XM_011529177.2

PREDICTED: Homo sapiens shieldin complex subunit 1 (SHLD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHLD1 (149840)
Length:
1151
CDS:
46..702

Additional Resources:

NCBI RefSeq record:
XM_011529177.2
NBCI Gene record:
SHLD1 (149840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136111 CCAGGACTGTCAAAGGATATT pLKO.1 640 CDS 100% 13.200 18.480 N SHLD1 n/a
2 TRCN0000133964 CCAATCCCAATTAAGTGCTTT pLKO.1 807 3UTR 100% 4.950 6.930 N SHLD1 n/a
3 TRCN0000442798 CCGTCTTACAGAGGCATTCCA pLKO_005 557 CDS 100% 3.000 4.200 N SHLD1 n/a
4 TRCN0000135052 CCAATTAAGTGCTTTGAGGTT pLKO.1 813 3UTR 100% 2.640 3.696 N SHLD1 n/a
5 TRCN0000425344 AGCGTGTGACATAAGAGATTA pLKO_005 150 CDS 100% 13.200 9.240 N SHLD1 n/a
6 TRCN0000432294 AGGATGATGGCCTTCGGAAAT pLKO_005 356 CDS 100% 10.800 7.560 N SHLD1 n/a
7 TRCN0000135433 GATCCAGACACCAGTAACTTA pLKO.1 256 CDS 100% 5.625 3.938 N SHLD1 n/a
8 TRCN0000424920 TGTGAAAGGCCAGTCAGAGAA pLKO_005 330 CDS 100% 4.950 3.465 N SHLD1 n/a
9 TRCN0000429227 CAAACTCACTCTCTGCATCTG pLKO_005 425 CDS 100% 4.050 2.835 N SHLD1 n/a
10 TRCN0000135612 GAGGCTTTCAGTTCTTTGGAA pLKO.1 205 CDS 100% 3.000 2.100 N SHLD1 n/a
11 TRCN0000134402 GCAGAATGTAATGAAAGACCT pLKO.1 678 CDS 100% 2.640 1.848 N SHLD1 n/a
12 TRCN0000442808 TGTCAGAGGAGAGCAGTGCTT pLKO_005 116 CDS 100% 2.640 1.848 N SHLD1 n/a
13 TRCN0000420124 TGGATAGATTCTATGAAATGT pLKO_005 380 CDS 100% 5.625 3.375 N SHLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05033 pDONR223 100% 94% 94% None 1_39del n/a
2 ccsbBroad304_05033 pLX_304 0% 94% 94% V5 1_39del n/a
Download CSV