Transcript: Mouse XM_006541381.3

PREDICTED: Mus musculus solute carrier family 25, member 43 (Slc25a43), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a43 (194744)
Length:
2142
CDS:
193..894

Additional Resources:

NCBI RefSeq record:
XM_006541381.3
NBCI Gene record:
Slc25a43 (194744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251565 CCGAAAGTTCGTTGTGCTATT pLKO_005 462 CDS 100% 10.800 15.120 N Slc25a43 n/a
2 TRCN0000251567 TGGATGACCTGGGCCGTATTT pLKO_005 485 CDS 100% 13.200 9.240 N Slc25a43 n/a
3 TRCN0000251566 GCTGGCTCCCTTCTAGTTTAC pLKO_005 727 CDS 100% 10.800 7.560 N Slc25a43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09828 pDONR223 100% 58.6% 58.6% None (many diffs) n/a
2 ccsbBroad304_09828 pLX_304 0% 58.6% 58.6% V5 (many diffs) n/a
3 TRCN0000465781 CCCGCTCTGTGTCGGCCCGTCTAC pLX_317 22.2% 58.6% 58.6% V5 (many diffs) n/a
Download CSV