Transcript: Human NM_001291847.2

Homo sapiens IKAROS family zinc finger 1 (IKZF1), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
IKZF1 (10320)
Length:
759
CDS:
222..455

Additional Resources:

NCBI RefSeq record:
NM_001291847.2
NBCI Gene record:
IKZF1 (10320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11482 pDONR223 100% 14.9% 10.9% None (many diffs) n/a
2 ccsbBroad304_11482 pLX_304 0% 14.9% 10.9% V5 (many diffs) n/a
3 TRCN0000479864 CTGCACAGGTGAAGTGAGACAATT pLX_317 16.8% 14.9% 10.9% V5 (many diffs) n/a
Download CSV