Transcript: Human NM_001351664.2

Homo sapiens mono-ADP ribosylhydrolase 2 (MACROD2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
MACROD2 (140733)
Length:
4524
CDS:
481..1203

Additional Resources:

NCBI RefSeq record:
NM_001351664.2
NBCI Gene record:
MACROD2 (140733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244143 ACGCATCTTTCAGGCATTATC pLKO_005 1430 3UTR 100% 13.200 18.480 N MACROD2 n/a
2 TRCN0000244141 ATGAGGTGGATCGGATCATTT pLKO_005 416 5UTR 100% 13.200 18.480 N MACROD2 n/a
3 TRCN0000244145 AGAATCGCAGAGCTCATATAT pLKO_005 885 CDS 100% 15.000 10.500 N MACROD2 n/a
4 TRCN0000244142 TTTCTCCGTAGACGATAATAA pLKO_005 492 CDS 100% 15.000 10.500 N MACROD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351664.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04946 pDONR223 100% 88.7% 88.7% None 281_361del n/a
2 ccsbBroad304_04946 pLX_304 0% 88.7% 88.7% V5 281_361del n/a
Download CSV