Transcript: Human NM_012404.3

Homo sapiens acidic nuclear phosphoprotein 32 family member D (ANP32D), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ANP32D (23519)
Length:
1064
CDS:
107..502

Additional Resources:

NCBI RefSeq record:
NM_012404.3
NBCI Gene record:
ANP32D (23519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144822 GAAGCTTGAACTAAGCAGTAA pLKO.1 307 CDS 100% 4.950 3.465 N ANP32D n/a
2 TRCN0000144208 CTCAATTGCAAACTTGCCAAA pLKO.1 271 CDS 100% 4.050 2.835 N ANP32D n/a
3 TRCN0000144951 GTCAAATGAAGGCAAATTGGA pLKO.1 190 CDS 100% 3.000 2.100 N ANP32D n/a
4 TRCN0000140318 CAAATTGGAAGGCCTCACAGA pLKO.1 202 CDS 100% 2.640 1.848 N ANP32D n/a
5 TRCN0000141530 CCTCAATTGCAAACTTGCCAA pLKO.1 270 CDS 100% 2.640 1.848 N ANP32D n/a
6 TRCN0000141137 CCTCACCTCAATTGCAAACTT pLKO.1 265 CDS 100% 5.625 3.375 N ANP32D n/a
7 TRCN0000139774 CCTGGACAACAGTCAGTCAAA pLKO.1 175 CDS 100% 4.950 2.970 N ANP32D n/a
8 TRCN0000142422 GCCTAGAAGTATTGGCAGAAA pLKO.1 342 CDS 100% 4.950 2.970 N ANP32D n/a
9 TRCN0000139547 CAATCAACATAGGCCTCACCT pLKO.1 252 CDS 100% 2.640 1.584 N ANP32D n/a
10 TRCN0000141940 GAAGGCCTCACAGATGAATTT pLKO.1 209 CDS 100% 13.200 6.600 Y ANP32D n/a
11 TRCN0000145535 CCTCACAGATGAATTTGAAGA pLKO.1 214 CDS 100% 4.950 2.475 Y ANP32D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11255 pDONR223 100% 51.5% 49.1% None (many diffs) n/a
2 ccsbBroad304_11255 pLX_304 0% 51.5% 49.1% V5 (many diffs) n/a
Download CSV