Transcript: Human XM_017003264.2

PREDICTED: Homo sapiens kelch like family member 29 (KLHL29), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL29 (114818)
Length:
4701
CDS:
132..2759

Additional Resources:

NCBI RefSeq record:
XM_017003264.2
NBCI Gene record:
KLHL29 (114818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365735 ACGCAGAGCGAAAGCGTTTAC pLKO_005 1097 CDS 100% 10.800 15.120 N KLHL29 n/a
2 TRCN0000376671 ACACGGCTGCGTCGTGATAAA pLKO_005 2717 CDS 100% 13.200 10.560 N KLHL29 n/a
3 TRCN0000365801 GCAATAGAGTTTCACGTATTT pLKO_005 3029 3UTR 100% 13.200 9.240 N KLHL29 n/a
4 TRCN0000365737 TCGTCTACGATGGGAAGATTT pLKO_005 2167 CDS 100% 13.200 9.240 N KLHL29 n/a
5 TRCN0000371023 AGAGCAAGCTTGATCCCTAAA pLKO_005 3087 3UTR 100% 10.800 7.560 N KLHL29 n/a
6 TRCN0000376672 GCGGCAAGATCTACGTGTTTG pLKO_005 2317 CDS 100% 10.800 7.560 N KLHL29 n/a
7 TRCN0000371069 TTTCAAGGACCTGATTCAAAG pLKO_005 1190 CDS 100% 10.800 7.560 N KLHL29 n/a
8 TRCN0000376264 TTTCAAGGACCTGATTCAAAG pLKO_005 1190 CDS 100% 10.800 7.560 N Klhl29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13040 pDONR223 100% 57.4% 57.4% None 1_597del;2097C>T;2107_2625del n/a
2 ccsbBroad304_13040 pLX_304 0% 57.4% 57.4% V5 1_597del;2097C>T;2107_2625del n/a
3 TRCN0000467139 CTGAATGACTCAAGCGAATCGATC pLX_317 30.2% 57.4% 57.4% V5 1_597del;2097C>T;2107_2625del n/a
Download CSV