Transcript: Human XM_011529266.3

PREDICTED: Homo sapiens chromosome 20 open reading frame 27 (C20orf27), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C20orf27 (54976)
Length:
1195
CDS:
169..645

Additional Resources:

NCBI RefSeq record:
XM_011529266.3
NBCI Gene record:
C20orf27 (54976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263509 GAAATGGGTTGAGCCCGAAAG pLKO_005 874 3UTR 100% 6.000 8.400 N C20orf27 n/a
2 TRCN0000263505 TCCTGCACAGGTATGAGATTA pLKO_005 422 CDS 100% 13.200 9.240 N C20orf27 n/a
3 TRCN0000264711 TCCTGCACAGGTATGAGATTA pLKO_005 422 CDS 100% 13.200 9.240 N 1700037H04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12128 pDONR223 100% 66.8% 66.8% None 19_93del;375_376ins123 n/a
2 ccsbBroad304_12128 pLX_304 0% 66.8% 66.8% V5 19_93del;375_376ins123 n/a
3 TRCN0000481494 TCCAACACATGATGACATGTCGAA pLX_317 88.1% 66.8% 66.8% V5 19_93del;375_376ins123 n/a
Download CSV