Transcript: Human NM_001367258.1

Homo sapiens stimulator of interferon response cGAMP interactor 1 (STING1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
STING1 (340061)
Length:
1943
CDS:
433..1215

Additional Resources:

NCBI RefSeq record:
NM_001367258.1
NBCI Gene record:
STING1 (340061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163296 GCCCGGATTCGAACTTACAAT pLKO.1 604 CDS 100% 5.625 7.875 N STING1 n/a
2 TRCN0000160895 GCATGGTCATATTACATCGGA pLKO.1 553 CDS 100% 0.750 1.050 N STING1 n/a
3 TRCN0000161345 GTCCAGGACTTGACATCTTAA pLKO.1 1336 3UTR 100% 13.200 9.240 N STING1 n/a
4 TRCN0000161052 GCTGGCATGGTCATATTACAT pLKO.1 549 CDS 100% 5.625 3.938 N STING1 n/a
5 TRCN0000134594 GTTTACAGCAACAGCATCTAT pLKO.1 790 CDS 100% 5.625 3.938 N STING1 n/a
6 TRCN0000164628 CCAACATTCGCTTCCTGGATA pLKO.1 725 CDS 100% 4.950 3.465 N STING1 n/a
7 TRCN0000135555 GCTGTATATTCTCCTCCCATT pLKO.1 666 CDS 100% 4.050 2.835 N STING1 n/a
8 TRCN0000160281 CATGGTCATATTACATCGGAT pLKO.1 554 CDS 100% 2.640 1.848 N STING1 n/a
9 TRCN0000163029 GCAGAGCTATTTCCTTCCACA pLKO.1 1296 3UTR 100% 2.640 1.584 N STING1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05465 pDONR223 100% 68.6% 68.6% None 0_1ins357 n/a
2 ccsbBroad304_05465 pLX_304 0% 68.6% 68.6% V5 0_1ins357 n/a
Download CSV