Transcript: Human NM_001863.5

Homo sapiens cytochrome c oxidase subunit 6B1 (COX6B1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
COX6B1 (1340)
Length:
488
CDS:
93..353

Additional Resources:

NCBI RefSeq record:
NM_001863.5
NBCI Gene record:
COX6B1 (1340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001863.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046287 GACCGCTAAAGGAGGCGATAT pLKO.1 224 CDS 100% 10.800 15.120 N COX6B1 n/a
2 TRCN0000046284 GCGATATCTCTGTGTGCGAAT pLKO.1 238 CDS 100% 4.050 5.670 N COX6B1 n/a
3 TRCN0000300409 GCGATATCTCTGTGTGCGAAT pLKO_005 238 CDS 100% 4.050 5.670 N COX6B1 n/a
4 TRCN0000304049 ACCGCTGTCAGAAGGCAATGA pLKO_005 205 CDS 100% 4.950 3.465 N COX6B1 n/a
5 TRCN0000046283 CCAACCAGAACCAGACTAGAA pLKO.1 157 CDS 100% 4.950 3.465 N COX6B1 n/a
6 TRCN0000310803 CGTTTCCCGGGAAGATCTGAA pLKO_005 334 CDS 100% 4.950 3.465 N COX6B1 n/a
7 TRCN0000046285 CTGGCAGAACTACCTGGACTT pLKO.1 182 CDS 100% 4.050 2.835 N COX6B1 n/a
8 TRCN0000300342 CTGGCAGAACTACCTGGACTT pLKO_005 182 CDS 100% 4.050 2.835 N COX6B1 n/a
9 TRCN0000304050 GACTAGAAACTGCTGGCAGAA pLKO_005 170 CDS 100% 4.050 2.835 N COX6B1 n/a
10 TRCN0000046286 TGGGATGAGCAACGGGCTGAA pLKO.1 309 CDS 100% 1.350 0.945 N COX6B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001863.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00353 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00353 pLX_304 0% 100% 100% V5 n/a
Download CSV