Transcript: Human XM_005244776.4

PREDICTED: Homo sapiens SKI proto-oncogene (SKI), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SKI (6497)
Length:
8826
CDS:
4056..5378

Additional Resources:

NCBI RefSeq record:
XM_005244776.4
NBCI Gene record:
SKI (6497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005244776.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235448 ACGTCTTACCGTGCCTATTAC pLKO_005 5483 3UTR 100% 13.200 10.560 N SKI n/a
2 TRCN0000235449 CAGTGTCAGCGAGTGAGAAAG pLKO_005 4339 CDS 100% 10.800 7.560 N SKI n/a
3 TRCN0000039712 AGACAGCTTCTACTCCTACAA pLKO.1 4391 CDS 100% 4.950 3.465 N SKI n/a
4 TRCN0000235450 CCTGCATGAGGTGGTCAAGAT pLKO_005 4877 CDS 100% 4.950 3.465 N SKI n/a
5 TRCN0000010438 CACATGACGCCATCTGAAGAC pLKO.1 5753 3UTR 100% 4.050 2.835 N SKI n/a
6 TRCN0000010437 GATCGAAGACCTGCAGGTGAA pLKO.1 5189 CDS 100% 4.050 2.835 N SKI n/a
7 TRCN0000039709 GCCAAAGAGAAGTTCCTGCAT pLKO.1 4863 CDS 100% 2.640 1.848 N SKI n/a
8 TRCN0000010439 GAATCTGCCACTCTCAGAATA pLKO.1 6605 3UTR 100% 13.200 7.920 N SKI n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 21 5UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 21 5UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005244776.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.