Transcript: Human XM_005245257.2

PREDICTED: Homo sapiens phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta (PIK3C2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3C2B (5287)
Length:
7661
CDS:
545..5449

Additional Resources:

NCBI RefSeq record:
XM_005245257.2
NBCI Gene record:
PIK3C2B (5287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219671 CCGTTGGAGTGCACCTAATTT pLKO.1 2842 CDS 100% 15.000 21.000 N PIK3C2B n/a
2 TRCN0000002121 CCTGTGGGAGAAGCGATATTA pLKO.1 3058 CDS 100% 15.000 21.000 N PIK3C2B n/a
3 TRCN0000195321 CCAGATGAACGGACCATAAAT pLKO.1 7492 3UTR 100% 15.000 12.000 N PIK3C2B n/a
4 TRCN0000002122 CGCTATGGCAACCGAAAGAAT pLKO.1 1418 CDS 100% 5.625 4.500 N PIK3C2B n/a
5 TRCN0000002123 CAACACATTCAACGCAGACTT pLKO.1 2347 CDS 100% 4.950 3.960 N PIK3C2B n/a
6 TRCN0000219672 ACAATGAGATGTTGGTATATG pLKO.1 5250 CDS 100% 13.200 9.240 N PIK3C2B n/a
7 TRCN0000194710 CAGTCATGAGTACATCCAATA pLKO.1 1870 CDS 100% 10.800 7.560 N PIK3C2B n/a
8 TRCN0000002119 CCTCCACTGTAGACTTGCTTA pLKO.1 1737 CDS 100% 4.950 3.465 N PIK3C2B n/a
9 TRCN0000197168 GCAATTACTAGGCTCAACTTG pLKO.1 1244 CDS 100% 4.950 3.465 N PIK3C2B n/a
10 TRCN0000002120 CCTCTTGTCTTCCCTACTTTA pLKO.1 6234 3UTR 100% 13.200 7.920 N PIK3C2B n/a
11 TRCN0000360889 CTTCATCATGGTGATGCATAT pLKO_005 5101 CDS 100% 10.800 6.480 N Pik3c2b n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7091 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7091 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.