Transcript: Human XM_005245332.5

PREDICTED: Homo sapiens DDB1 and CUL4 associated factor 6 (DCAF6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAF6 (55827)
Length:
3336
CDS:
251..2935

Additional Resources:

NCBI RefSeq record:
XM_005245332.5
NBCI Gene record:
DCAF6 (55827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245332.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128516 CAGAAACTTCAGATCAGACTA pLKO.1 2133 CDS 100% 4.950 3.465 N DCAF6 n/a
2 TRCN0000352974 CAGAAACTTCAGATCAGACTA pLKO_005 2133 CDS 100% 4.950 3.465 N DCAF6 n/a
3 TRCN0000130604 CCCTCATTCTACTCCTTTGCT pLKO.1 1540 CDS 100% 3.000 2.100 N DCAF6 n/a
4 TRCN0000344154 CCCTCATTCTACTCCTTTGCT pLKO_005 1540 CDS 100% 3.000 2.100 N DCAF6 n/a
5 TRCN0000129155 GAGCATTTGATGCTTCTGGAA pLKO.1 2606 CDS 100% 2.640 1.848 N DCAF6 n/a
6 TRCN0000344155 GAGCATTTGATGCTTCTGGAA pLKO_005 2606 CDS 100% 2.640 1.848 N DCAF6 n/a
7 TRCN0000130121 CCTGAAGAATCATCAGAGGAT pLKO.1 1928 CDS 100% 2.640 1.584 N DCAF6 n/a
8 TRCN0000129688 CTGAACAATTTCTTCAGCCTT pLKO.1 1464 CDS 100% 0.264 0.158 N DCAF6 n/a
9 TRCN0000344037 CTGAACAATTTCTTCAGCCTT pLKO_005 1464 CDS 100% 0.264 0.158 N DCAF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245332.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.