Transcript: Human XM_005246196.3

PREDICTED: Homo sapiens growth regulating estrogen receptor binding 1 (GREB1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GREB1 (9687)
Length:
5559
CDS:
109..3225

Additional Resources:

NCBI RefSeq record:
XM_005246196.3
NBCI Gene record:
GREB1 (9687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273203 TTCGCACTATCAGGGTATAAA pLKO_005 1653 CDS 100% 15.000 21.000 N GREB1 n/a
2 TRCN0000273201 TTTGTAGCGGTGCCAGTATTT pLKO_005 3582 3UTR 100% 13.200 10.560 N GREB1 n/a
3 TRCN0000000297 GTCACGAACATGGGCTCTTTA pLKO.1 2033 CDS 100% 13.200 9.240 N GREB1 n/a
4 TRCN0000000296 CAAAGGAGAAAGGACCACATT pLKO.1 3973 3UTR 100% 4.950 3.465 N GREB1 n/a
5 TRCN0000000300 GCCTTCTCTTACTCCATGCTA pLKO.1 1852 CDS 100% 3.000 2.100 N GREB1 n/a
6 TRCN0000273158 GCCTTCTCTTACTCCATGCTA pLKO_005 1852 CDS 100% 3.000 2.100 N GREB1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4514 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4514 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.