Transcript: Human XM_005246299.4

PREDICTED: Homo sapiens ubiquitin protein ligase E3 component n-recognin 3 (UBR3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBR3 (130507)
Length:
8025
CDS:
46..5757

Additional Resources:

NCBI RefSeq record:
XM_005246299.4
NBCI Gene record:
UBR3 (130507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246299.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419583 TGATCAATGCATCGGTAATTA pLKO_005 5540 CDS 100% 15.000 21.000 N UBR3 n/a
2 TRCN0000034103 CCTTACGCAAAGACCACTTTA pLKO.1 4739 CDS 100% 13.200 18.480 N UBR3 n/a
3 TRCN0000034102 CGAGGCAAACCTCTCTACATT pLKO.1 5641 CDS 100% 5.625 7.875 N UBR3 n/a
4 TRCN0000034101 CCGTTCATGATGTGAGGCTTT pLKO.1 3950 CDS 100% 4.050 5.670 N UBR3 n/a
5 TRCN0000191533 GCACCAAAGATCAATCCATAA pLKO.1 1142 CDS 100% 10.800 8.640 N Ubr3 n/a
6 TRCN0000430285 AGCATTGACTCTGAGTATAAT pLKO_005 4585 CDS 100% 15.000 10.500 N UBR3 n/a
7 TRCN0000430185 CATTGCATCGTATCATCATTT pLKO_005 5771 3UTR 100% 13.200 9.240 N UBR3 n/a
8 TRCN0000034099 GCAGTATATGACTGTGTTATT pLKO.1 3772 CDS 100% 13.200 9.240 N UBR3 n/a
9 TRCN0000436376 TTGCATCTGCCAAGCATAATG pLKO_005 6143 3UTR 100% 13.200 9.240 N UBR3 n/a
10 TRCN0000415174 TTTGCTCATCCAGATCTTAAT pLKO_005 4707 CDS 100% 13.200 9.240 N UBR3 n/a
11 TRCN0000434283 TTAGTAGCAGAACGTAGAAAG pLKO_005 3190 CDS 100% 10.800 7.560 N UBR3 n/a
12 TRCN0000034100 GCTTTGTGATAAGTGAACTAT pLKO.1 4916 CDS 100% 5.625 3.938 N UBR3 n/a
13 TRCN0000367245 TACTTAAGAGAAGGCTATAAT pLKO_005 703 CDS 100% 15.000 9.000 N Ubr3 n/a
14 TRCN0000413730 TACTTAAGAGAAGGCTATAAT pLKO_005 703 CDS 100% 15.000 9.000 N UBR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246299.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.