Transcript: Human XM_005246467.3

PREDICTED: Homo sapiens glutaminase (GLS), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLS (2744)
Length:
4547
CDS:
265..1944

Additional Resources:

NCBI RefSeq record:
XM_005246467.3
NBCI Gene record:
GLS (2744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051137 GATGGTGTCATGCTAGACAAA pLKO.1 835 CDS 100% 4.950 6.930 N GLS n/a
2 TRCN0000299001 GATGGTGTCATGCTAGACAAA pLKO_005 835 CDS 100% 4.950 6.930 N GLS n/a
3 TRCN0000051133 CCTCACACATTGATGAGTTAT pLKO.1 947 CDS 100% 13.200 10.560 N GLS n/a
4 TRCN0000299002 CCTCACACATTGATGAGTTAT pLKO_005 947 CDS 100% 13.200 10.560 N GLS n/a
5 TRCN0000253163 AGAAAGTGGAGATCGAAATTT pLKO_005 1410 CDS 100% 15.000 10.500 N Gls n/a
6 TRCN0000051135 GCACAGACATGGTTGGTATAT pLKO.1 1475 CDS 100% 13.200 9.240 N GLS n/a
7 TRCN0000298987 GCACAGACATGGTTGGTATAT pLKO_005 1475 CDS 100% 13.200 9.240 N GLS n/a
8 TRCN0000051136 GCCCTGAAGCAGTTCGAAATA pLKO.1 1610 CDS 100% 13.200 9.240 N GLS n/a
9 TRCN0000299000 GCCCTGAAGCAGTTCGAAATA pLKO_005 1610 CDS 100% 13.200 9.240 N GLS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.