Transcript: Human XM_005246587.1

PREDICTED: Homo sapiens NGFI-A binding protein 1 (NAB1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAB1 (4664)
Length:
3859
CDS:
53..1426

Additional Resources:

NCBI RefSeq record:
XM_005246587.1
NBCI Gene record:
NAB1 (4664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234725 CAGATCACTGTCACGTATATA pLKO_005 2973 3UTR 100% 15.000 21.000 N NAB1 n/a
2 TRCN0000234723 TAACGGCTTGACTTCCGATAA pLKO_005 1186 CDS 100% 10.800 15.120 N NAB1 n/a
3 TRCN0000020050 CCGAATGCCTAATTTACAGAA pLKO.1 1240 CDS 100% 4.950 6.930 N NAB1 n/a
4 TRCN0000020051 GCAGTAGTTATGAAAGGAGTA pLKO.1 384 CDS 100% 4.050 3.240 N NAB1 n/a
5 TRCN0000345407 AGTAGCATACCCATCTATAAA pLKO_005 326 CDS 100% 15.000 10.500 N Nab1 n/a
6 TRCN0000234724 GAATCTCCGAATGCCTAATTT pLKO_005 1234 CDS 100% 15.000 10.500 N NAB1 n/a
7 TRCN0000020053 CAACTCTGTGTGAAGGATAAT pLKO.1 896 CDS 100% 13.200 9.240 N NAB1 n/a
8 TRCN0000020049 CCACACAAAGAGGAGGAAATT pLKO.1 779 CDS 100% 13.200 9.240 N NAB1 n/a
9 TRCN0000234721 GGAATATCCTGCAGTAGTTAT pLKO_005 374 CDS 100% 13.200 9.240 N NAB1 n/a
10 TRCN0000234722 TTGCCTTGGCTCGACAGATTT pLKO_005 945 CDS 100% 13.200 9.240 N NAB1 n/a
11 TRCN0000020052 GCTCGACAGATTTCTCGAGAA pLKO.1 953 CDS 100% 0.000 0.000 N NAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.