Transcript: Human XM_005246993.3

PREDICTED: Homo sapiens autophagy related 4B cysteine peptidase (ATG4B), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG4B (23192)
Length:
2867
CDS:
57..1274

Additional Resources:

NCBI RefSeq record:
XM_005246993.3
NBCI Gene record:
ATG4B (23192)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365104 CATTCACCAGATAGCGCAAAT pLKO_005 428 CDS 100% 10.800 15.120 N ATG4B n/a
2 TRCN0000370106 CAGCGTCCTCAACGCATTCAT pLKO_005 383 CDS 100% 5.625 7.875 N ATG4B n/a
3 TRCN0000073798 CCGTTTGGATACTGGGTAGAA pLKO.1 130 CDS 100% 4.950 6.930 N ATG4B n/a
4 TRCN0000370104 GTCAGACACAGACATGAATTT pLKO_005 1636 3UTR 100% 13.200 9.240 N ATG4B n/a
5 TRCN0000365106 GTGGTTGGTTTGGAATTAAAG pLKO_005 1601 3UTR 100% 13.200 9.240 N ATG4B n/a
6 TRCN0000365107 GGTGTGGACAGATGATCTTTG pLKO_005 286 CDS 100% 10.800 7.560 N ATG4B n/a
7 TRCN0000365105 TGATGTGGCATCTAGACTTTG pLKO_005 188 CDS 100% 10.800 7.560 N ATG4B n/a
8 TRCN0000370105 GAAGCTTGCTGTCTTCGATAC pLKO_005 515 CDS 100% 6.000 4.200 N ATG4B n/a
9 TRCN0000073799 CGGTGTGGACAGATGATCTTT pLKO.1 285 CDS 100% 5.625 3.938 N ATG4B n/a
10 TRCN0000073801 CGGTTTGCTGAGTTTGAAGAT pLKO.1 90 CDS 100% 4.950 3.465 N ATG4B n/a
11 TRCN0000073800 GAAAGATTCTTCGACTCAGAA pLKO.1 1224 CDS 100% 4.950 3.465 N ATG4B n/a
12 TRCN0000073802 CACTACTTCATCGGCTACGTT pLKO.1 846 CDS 100% 3.000 2.100 N ATG4B n/a
13 TRCN0000030943 CCCATGTTTGAGCTGGTGGAA pLKO.1 1095 CDS 100% 2.640 1.848 N Atg4b n/a
14 TRCN0000308684 CCCATGTTTGAGCTGGTGGAA pLKO_005 1095 CDS 100% 2.640 1.848 N Atg4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.