Transcript: Human XM_005247362.2

PREDICTED: Homo sapiens MORC family CW-type zinc finger 1 (MORC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MORC1 (27136)
Length:
3806
CDS:
45..3089

Additional Resources:

NCBI RefSeq record:
XM_005247362.2
NBCI Gene record:
MORC1 (27136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002052 GCGTGGTTGGAATTGTTAATA pLKO.1 1231 CDS 100% 15.000 21.000 N MORC1 n/a
2 TRCN0000433653 TCCAATGCCCTCATGGTTAAT pLKO_005 476 CDS 100% 13.200 18.480 N MORC1 n/a
3 TRCN0000434206 GTATTCCCTAATCCAATTATC pLKO_005 3273 3UTR 100% 13.200 9.240 N MORC1 n/a
4 TRCN0000002049 TGTGGTACTTTGCTGGTTATT pLKO.1 624 CDS 100% 13.200 9.240 N MORC1 n/a
5 TRCN0000002050 GAATACTTACATGGTCCAATA pLKO.1 2744 CDS 100% 10.800 7.560 N MORC1 n/a
6 TRCN0000002051 CCCAGAGAAGTCAGATTGCTA pLKO.1 2143 CDS 100% 3.000 2.100 N MORC1 n/a
7 TRCN0000002048 GCCTCAATTTATACCAGTGGA pLKO.1 1838 CDS 100% 2.640 1.848 N MORC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08061 pDONR223 100% 97% 96.8% None 1331_1420del;1498T>A n/a
2 ccsbBroad304_08061 pLX_304 0% 97% 96.8% V5 1331_1420del;1498T>A n/a
Download CSV