Transcript: Human XM_005248013.3

PREDICTED: Homo sapiens acyl-CoA oxidase 3, pristanoyl (ACOX3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOX3 (8310)
Length:
2878
CDS:
146..2020

Additional Resources:

NCBI RefSeq record:
XM_005248013.3
NBCI Gene record:
ACOX3 (8310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425362 GCAAGCGGATCTTCGAGTATG pLKO_005 390 CDS 100% 10.800 15.120 N ACOX3 n/a
2 TRCN0000046145 CGGCAGTAATACCAAGGCCAT pLKO.1 634 CDS 100% 2.160 3.024 N ACOX3 n/a
3 TRCN0000046143 GCAGCAGACAAGCAACTATTT pLKO.1 1519 CDS 100% 13.200 9.240 N ACOX3 n/a
4 TRCN0000420251 ATCTGGGATCGCGGTGATTTG pLKO_005 2370 3UTR 100% 10.800 7.560 N ACOX3 n/a
5 TRCN0000413208 TAATTAGAATTTCGCACATTC pLKO_005 2449 3UTR 100% 10.800 7.560 N ACOX3 n/a
6 TRCN0000046144 CCTGTCATAGGAAGTCTGAAA pLKO.1 2148 3UTR 100% 4.950 3.465 N ACOX3 n/a
7 TRCN0000046146 CCATTTCTCCAAGTCGCTCTT pLKO.1 1246 CDS 100% 4.050 2.835 N ACOX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01888 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01888 pLX_304 0% 100% 100% V5 n/a
Download CSV