Transcript: Human XM_005248034.3

PREDICTED: Homo sapiens transmembrane protein 128 (TMEM128), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM128 (85013)
Length:
2073
CDS:
31..528

Additional Resources:

NCBI RefSeq record:
XM_005248034.3
NBCI Gene record:
TMEM128 (85013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131186 GCCTTGATACCCATTACCACT pLKO.1 382 CDS 100% 2.640 3.696 N TMEM128 n/a
2 TRCN0000130577 CCTGGAATGGTATTGTGGAAT pLKO.1 336 CDS 100% 4.950 3.960 N TMEM128 n/a
3 TRCN0000128448 GCAGGAATTTGCTTCAACATT pLKO.1 418 CDS 100% 5.625 3.938 N TMEM128 n/a
4 TRCN0000128276 GAAACCTCTTCCAAGACTTAA pLKO.1 156 CDS 100% 13.200 7.920 N TMEM128 n/a
5 TRCN0000128524 CTTTGGAGAAAGTGGTTTCAT pLKO.1 1720 3UTR 100% 5.625 2.813 Y TMEM128 n/a
6 TRCN0000128467 GAATGGTTAAACATCCAGCTA pLKO.1 1492 3UTR 100% 2.640 1.320 Y TMEM128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248034.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04468 pDONR223 100% 80.9% 78.8% None (many diffs) n/a
2 ccsbBroad304_04468 pLX_304 0% 80.9% 78.8% V5 (many diffs) n/a
Download CSV