Transcript: Human XM_005248275.5

PREDICTED: Homo sapiens nicotinamide nucleotide transhydrogenase (NNT), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NNT (23530)
Length:
3900
CDS:
984..2744

Additional Resources:

NCBI RefSeq record:
XM_005248275.5
NBCI Gene record:
NNT (23530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248275.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221880 CGAGAAGCTAATAGCATTATT pLKO.1 2247 CDS 100% 15.000 21.000 N NNT n/a
2 TRCN0000278376 CGAGAAGCTAATAGCATTATT pLKO_005 2247 CDS 100% 15.000 21.000 N NNT n/a
3 TRCN0000221876 GCACCTTTGTTGGTGGATATT pLKO.1 1291 CDS 100% 13.200 18.480 N NNT n/a
4 TRCN0000297432 GCACCTTTGTTGGTGGATATT pLKO_005 1291 CDS 100% 13.200 18.480 N NNT n/a
5 TRCN0000221878 CGTCGTTATCACTGTGCTGAA pLKO.1 1979 CDS 100% 4.050 5.670 N NNT n/a
6 TRCN0000278312 CGTCGTTATCACTGTGCTGAA pLKO_005 1979 CDS 100% 4.050 5.670 N NNT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248275.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15765 pDONR223 0% 35.2% 35.3% None 1_1137del;1398A>G n/a
2 ccsbBroad304_15765 pLX_304 0% 35.2% 35.3% V5 1_1137del;1398A>G n/a
Download CSV