Transcript: Human XM_005249593.4

PREDICTED: Homo sapiens nucleoporin 42 (NUP42), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP42 (11097)
Length:
2684
CDS:
1441..2418

Additional Resources:

NCBI RefSeq record:
XM_005249593.4
NBCI Gene record:
NUP42 (11097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129199 CCAGTTCAGGTATCTCTACTT pLKO.1 1976 CDS 100% 4.950 6.930 N NUP42 n/a
2 TRCN0000422186 ATGTAAAGGATGGAGTAAATC pLKO_005 1763 CDS 100% 13.200 9.240 N NUP42 n/a
3 TRCN0000130187 CCACCTCTGGAACTTCTAAAT pLKO.1 2392 CDS 100% 13.200 9.240 N NUP42 n/a
4 TRCN0000435158 GAATATAAGCTTCCATCAATA pLKO_005 2515 3UTR 100% 13.200 9.240 N NUP42 n/a
5 TRCN0000430737 TAACTTCTTAACCAGCAATAA pLKO_005 1560 CDS 100% 13.200 9.240 N NUP42 n/a
6 TRCN0000419844 TACAACTAGCCAGAGATATTC pLKO_005 1215 5UTR 100% 13.200 9.240 N NUP42 n/a
7 TRCN0000431874 GATTCTGGAGCTTCAACTAAC pLKO_005 1321 5UTR 100% 10.800 7.560 N NUP42 n/a
8 TRCN0000437474 GTCATCCAGCCATCCAGTTTC pLKO_005 1240 5UTR 100% 10.800 7.560 N NUP42 n/a
9 TRCN0000128180 CCTCTGGAACTTCTAAATGTT pLKO.1 2395 CDS 100% 5.625 3.938 N NUP42 n/a
10 TRCN0000194170 GAAACTTCTGGAAGGAATTGT pLKO.1 1413 5UTR 100% 5.625 3.938 N Nupl2 n/a
11 TRCN0000130430 GCAGTGATAATGCTCAGAACT pLKO.1 1862 CDS 100% 4.950 3.465 N NUP42 n/a
12 TRCN0000129028 GCAGCATCATTGCAACAGATA pLKO.1 2276 CDS 100% 4.950 2.970 N NUP42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249593.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11593 pDONR223 100% 22.5% 22% None 0_1ins369;299_315del;321_975del n/a
2 ccsbBroad304_11593 pLX_304 0% 22.5% 22% V5 0_1ins369;299_315del;321_975del n/a
3 TRCN0000473939 CCCCCAGAGACTCTGGACACTATT pLX_317 73.4% 22.5% 22% V5 0_1ins369;299_315del;321_975del n/a
Download CSV