Transcript: Human XM_005249997.3

PREDICTED: Homo sapiens RAB19, member RAS oncogene family (RAB19), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB19 (401409)
Length:
1849
CDS:
501..1118

Additional Resources:

NCBI RefSeq record:
XM_005249997.3
NBCI Gene record:
RAB19 (401409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249997.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382328 GACGTGTGTGGTGCAGCATTT pLKO_005 590 CDS 100% 10.800 8.640 N RAB19 n/a
2 TRCN0000073015 GCATTTCAAGTCTGGAGTCTA pLKO.1 605 CDS 100% 4.950 3.960 N RAB19 n/a
3 TRCN0000381629 ACACGATTGGAGTGGACTTTA pLKO_005 643 CDS 100% 13.200 9.240 N RAB19 n/a
4 TRCN0000380395 GATGAGAACTTTGACTATTTG pLKO_005 531 CDS 100% 13.200 9.240 N RAB19 n/a
5 TRCN0000380145 CCAAGGAGTCAAAGAACATAG pLKO_005 949 CDS 100% 10.800 7.560 N RAB19 n/a
6 TRCN0000381517 CTCACTGGATTCATGAGATAG pLKO_005 790 CDS 100% 10.800 7.560 N RAB19 n/a
7 TRCN0000048445 GCCAAGGAGTCAAAGAACATA pLKO.1 948 CDS 100% 5.625 3.938 N LOC442624 n/a
8 TRCN0000048446 CCCTCACTGGATTCATGAGAT pLKO.1 788 CDS 100% 4.950 3.465 N LOC442624 n/a
9 TRCN0000073016 CCTCACTGGATTCATGAGATA pLKO.1 789 CDS 100% 4.950 3.465 N RAB19 n/a
10 TRCN0000073014 GCAGATGAGAACTTTGACTAT pLKO.1 528 CDS 100% 4.950 3.465 N RAB19 n/a
11 TRCN0000379818 ATAAATGTGACCTCTGGGAAA pLKO_005 853 CDS 100% 4.050 2.835 N RAB19 n/a
12 TRCN0000381017 GGAGTCTACACTGAGACACAG pLKO_005 618 CDS 100% 4.050 2.835 N RAB19 n/a
13 TRCN0000380788 CCATCATCGCCTATGACCTCA pLKO_005 742 CDS 100% 2.640 1.848 N RAB19 n/a
14 TRCN0000382391 AGCTGCAAATGTGGTCATTAT pLKO_005 821 CDS 100% 13.200 7.920 N RAB19 n/a
15 TRCN0000048443 GAGCTGCAAATGTGGTCATTA pLKO.1 820 CDS 100% 13.200 7.920 N LOC442624 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249997.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10131 pDONR223 100% 94.1% 5.3% None 12C>G;34G>T;165_166ins36 n/a
2 ccsbBroad304_10131 pLX_304 0% 94.1% 5.3% V5 (not translated due to prior stop codon) 12C>G;34G>T;165_166ins36 n/a
Download CSV