Transcript: Human XM_005251134.5

PREDICTED: Homo sapiens ADP ribosylation factor guanine nucleotide exchange factor 1 (ARFGEF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARFGEF1 (10565)
Length:
7175
CDS:
365..5914

Additional Resources:

NCBI RefSeq record:
XM_005251134.5
NBCI Gene record:
ARFGEF1 (10565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251134.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253384 GATATGGTTGTACGGTGTATA pLKO_005 4124 CDS 100% 13.200 18.480 N Arfgef1 n/a
2 TRCN0000048279 CGGCAGCATCATCATCTGTTA pLKO.1 1040 CDS 100% 4.950 3.960 N ARFGEF1 n/a
3 TRCN0000289953 CGGCAGCATCATCATCTGTTA pLKO_005 1040 CDS 100% 4.950 3.960 N ARFGEF1 n/a
4 TRCN0000048278 CCCTCTCTTATGTGAAATTAT pLKO.1 5776 CDS 100% 15.000 10.500 N ARFGEF1 n/a
5 TRCN0000289952 CCCTCTCTTATGTGAAATTAT pLKO_005 5776 CDS 100% 15.000 10.500 N ARFGEF1 n/a
6 TRCN0000048281 CCAGAACAACAGACAGAGAAA pLKO.1 4685 CDS 100% 4.950 3.465 N ARFGEF1 n/a
7 TRCN0000289879 CCAGAACAACAGACAGAGAAA pLKO_005 4685 CDS 100% 4.950 3.465 N ARFGEF1 n/a
8 TRCN0000048282 GCCTGGACTAACTTACTGCTT pLKO.1 5690 CDS 100% 2.640 1.848 N ARFGEF1 n/a
9 TRCN0000289950 GCCTGGACTAACTTACTGCTT pLKO_005 5690 CDS 100% 2.640 1.848 N ARFGEF1 n/a
10 TRCN0000048280 CCTGATGAATTTGTGGGTTTA pLKO.1 3626 CDS 100% 10.800 6.480 N ARFGEF1 n/a
11 TRCN0000289951 CCTGATGAATTTGTGGGTTTA pLKO_005 3626 CDS 100% 10.800 6.480 N ARFGEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251134.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.