Transcript: Human XM_005251439.5

PREDICTED: Homo sapiens F-box protein 10 (FBXO10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO10 (26267)
Length:
2647
CDS:
140..2101

Additional Resources:

NCBI RefSeq record:
XM_005251439.5
NBCI Gene record:
FBXO10 (26267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265436 ACTTACGCAGTGCGGTGTATA pLKO_005 1526 CDS 100% 13.200 18.480 N FBXO10 n/a
2 TRCN0000253918 GTACGAAGAGCAAGGTGAAAT pLKO_005 559 CDS 100% 13.200 18.480 N FBXO10 n/a
3 TRCN0000253920 TCATGCTCAGGAACGACATTT pLKO_005 1563 CDS 100% 13.200 9.240 N FBXO10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11823 pDONR223 100% 17.8% 17.9% None (many diffs) n/a
2 TRCN0000476677 TAACGCTGTCCAACGACTGAAGGA pLX_317 22.6% 17.8% 17.9% V5 (many diffs) n/a
Download CSV