Transcript: Human XM_005251634.2

PREDICTED: Homo sapiens zinc finger and BTB domain containing 5 (ZBTB5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB5 (9925)
Length:
5874
CDS:
1439..3472

Additional Resources:

NCBI RefSeq record:
XM_005251634.2
NBCI Gene record:
ZBTB5 (9925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137283 GCCAGTTGTCAGACTGAATTT pLKO.1 3501 3UTR 100% 13.200 18.480 N ZBTB5 n/a
2 TRCN0000136728 GCGATCATGTTTGATCAGTCT pLKO.1 2207 CDS 100% 0.264 0.370 N ZBTB5 n/a
3 TRCN0000330242 ACCTTCTGATGGGAGTATTAT pLKO_005 3831 3UTR 100% 15.000 12.000 N ZBTB5 n/a
4 TRCN0000330306 GGGTAGGTGATATCCATATTT pLKO_005 2601 CDS 100% 15.000 10.500 N ZBTB5 n/a
5 TRCN0000330239 AGGCATGTAAACATTACTTAA pLKO_005 1776 CDS 100% 13.200 9.240 N ZBTB5 n/a
6 TRCN0000330309 TCGTGAGCTCAGCCCTCAATT pLKO_005 1896 CDS 100% 13.200 9.240 N ZBTB5 n/a
7 TRCN0000136992 CCATAGATGAGTCTGCCATTT pLKO.1 2061 CDS 100% 10.800 7.560 N ZBTB5 n/a
8 TRCN0000330243 TAGAGGGAGCTCGCAAGTATG pLKO_005 3258 CDS 100% 10.800 7.560 N ZBTB5 n/a
9 TRCN0000134016 CTCTGTTGTTAAGGCATGTAA pLKO.1 1765 CDS 100% 5.625 3.938 N ZBTB5 n/a
10 TRCN0000138213 CCAGGAAGATAGTGCGATCAT pLKO.1 2194 CDS 100% 4.950 3.465 N ZBTB5 n/a
11 TRCN0000137377 GCTGAAGCATAAGTGGACTTT pLKO.1 5449 3UTR 100% 4.950 3.465 N ZBTB5 n/a
12 TRCN0000137350 GCTCTGTGATTGTGTCATTGT pLKO.1 1504 CDS 100% 4.950 2.970 N ZBTB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.