Transcript: Human XM_005251773.3

PREDICTED: Homo sapiens ATP binding cassette subfamily A member 1 (ABCA1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCA1 (19)
Length:
10413
CDS:
314..7105

Additional Resources:

NCBI RefSeq record:
XM_005251773.3
NBCI Gene record:
ABCA1 (19)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029091 CCTCCGAGTCAAGAAGTTAAT pLKO.1 4955 CDS 100% 13.200 10.560 N ABCA1 n/a
2 TRCN0000029090 CCCGGAGTTGTTGGAAACTTT pLKO.1 584 CDS 100% 5.625 4.500 N ABCA1 n/a
3 TRCN0000276420 ACCTATGTGAAACTCTATTAT pLKO_005 7356 3UTR 100% 15.000 10.500 N ABCA1 n/a
4 TRCN0000276482 TAGTCCTCTTTCCCGCATTAT pLKO_005 1405 CDS 100% 13.200 9.240 N ABCA1 n/a
5 TRCN0000029092 GCCTCGTGAAGTATGGAGAAA pLKO.1 6417 CDS 100% 4.950 3.465 N ABCA1 n/a
6 TRCN0000276421 GCCTCGTGAAGTATGGAGAAA pLKO_005 6417 CDS 100% 4.950 3.465 N ABCA1 n/a
7 TRCN0000029093 GCTGTGGAAGAACCTCACTTT pLKO.1 343 CDS 100% 4.950 3.465 N ABCA1 n/a
8 TRCN0000285566 GCTGTGGAAGAACCTCACTTT pLKO_005 343 CDS 100% 4.950 3.465 N ABCA1 n/a
9 TRCN0000029089 GCCTCTATTTATCTTCCTGAT pLKO.1 406 CDS 100% 4.050 2.835 N ABCA1 n/a
10 TRCN0000276419 GCCTCTATTTATCTTCCTGAT pLKO_005 406 CDS 100% 4.050 2.835 N ABCA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.