Transcript: Human XM_005251837.2

PREDICTED: Homo sapiens structural maintenance of chromosomes 5 (SMC5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMC5 (23137)
Length:
5304
CDS:
118..3378

Additional Resources:

NCBI RefSeq record:
XM_005251837.2
NBCI Gene record:
SMC5 (23137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147948 GCATTATGTGAAGGCGAAATA pLKO.1 1360 CDS 100% 13.200 18.480 N SMC5 n/a
2 TRCN0000330919 GCATTATGTGAAGGCGAAATA pLKO_005 1360 CDS 100% 13.200 18.480 N SMC5 n/a
3 TRCN0000148162 GCGAAACTTGTTACCGAATTA pLKO.1 2356 CDS 100% 13.200 18.480 N SMC5 n/a
4 TRCN0000330920 GCGAAACTTGTTACCGAATTA pLKO_005 2356 CDS 100% 13.200 18.480 N SMC5 n/a
5 TRCN0000146759 CAACAGATATTAAGGAGGCAT pLKO.1 1100 CDS 100% 2.640 3.696 N SMC5 n/a
6 TRCN0000330921 TACAGTGGAAGAAGGGTTAAT pLKO_005 3666 3UTR 100% 13.200 9.240 N SMC5 n/a
7 TRCN0000147918 GAGGTGAAAGAAGTGTTTCTA pLKO.1 3050 CDS 100% 5.625 3.938 N SMC5 n/a
8 TRCN0000353776 GAGGTGAAAGAAGTGTTTCTA pLKO_005 3050 CDS 100% 5.625 3.938 N SMC5 n/a
9 TRCN0000147348 GAGAAAGAATTGAACGGGTAA pLKO.1 1907 CDS 100% 4.050 2.835 N SMC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.