Transcript: Human XM_005252268.2

PREDICTED: Homo sapiens GTPase activating Rap/RanGAP domain like 3 (GARNL3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GARNL3 (84253)
Length:
3761
CDS:
250..3360

Additional Resources:

NCBI RefSeq record:
XM_005252268.2
NBCI Gene record:
GARNL3 (84253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048308 CGCTCCCACTTTACACATATT pLKO.1 1285 CDS 100% 13.200 18.480 N GARNL3 n/a
2 TRCN0000048309 GCAGCTATTGATGTGTACGAA pLKO.1 2425 CDS 100% 3.000 4.200 N GARNL3 n/a
3 TRCN0000048312 CCTTGGAAAGTGCTTCTACTT pLKO.1 3203 CDS 100% 4.950 3.465 N GARNL3 n/a
4 TRCN0000048310 GCCATATTCCAAAGAGAACAA pLKO.1 1164 CDS 100% 4.950 3.465 N GARNL3 n/a
5 TRCN0000106232 CCCGTGTTTGACAGAACTCTA pLKO.1 1879 CDS 100% 4.950 3.465 N Garnl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15192 pDONR223 82.6% 95.6% 33.7% None (many diffs) n/a
2 ccsbBroad304_15192 pLX_304 0% 95.6% 33.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV