Transcript: Human XM_005253239.3

PREDICTED: Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD44 (960)
Length:
4942
CDS:
137..1873

Additional Resources:

NCBI RefSeq record:
XM_005253239.3
NBCI Gene record:
CD44 (960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296191 GGACCAATTACCATAACTATT pLKO_005 557 CDS 100% 13.200 18.480 N CD44 n/a
2 TRCN0000308110 CCGTTGGAAACATAACCATTA pLKO_005 1904 3UTR 100% 10.800 15.120 N CD44 n/a
3 TRCN0000057564 CCTCCCAGTATGACACATATT pLKO.1 468 CDS 100% 13.200 10.560 N CD44 n/a
4 TRCN0000289233 CCTCCCAGTATGACACATATT pLKO_005 468 CDS 100% 13.200 10.560 N CD44 n/a
5 TRCN0000296190 ATGGACTCCAGTCATAGTATA pLKO_005 1061 CDS 100% 13.200 9.240 N CD44 n/a
6 TRCN0000057563 GCCCTATTAGTGATTTCCAAA pLKO.1 2945 3UTR 100% 4.950 3.465 N CD44 n/a
7 TRCN0000057567 CGCTATGTCCAGAAAGGAGAA pLKO.1 596 CDS 100% 4.050 2.835 N CD44 n/a
8 TRCN0000289308 CGCTATGTCCAGAAAGGAGAA pLKO_005 596 CDS 100% 4.050 2.835 N CD44 n/a
9 TRCN0000057566 CCAACTCTAATGTCAATCGTT pLKO.1 1425 CDS 100% 3.000 2.100 N CD44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05963 pDONR223 100% 72% 71.6% None (many diffs) n/a
2 ccsbBroad304_05963 pLX_304 0% 72% 71.6% V5 (many diffs) n/a
Download CSV