Transcript: Human XM_005254397.4

PREDICTED: Homo sapiens myosin VA (MYO5A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO5A (4644)
Length:
7894
CDS:
77..5719

Additional Resources:

NCBI RefSeq record:
XM_005254397.4
NBCI Gene record:
MYO5A (4644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379516 GCTGGTTTATGAAGGGTTAAA pLKO_005 4084 CDS 100% 13.200 18.480 N MYO5A n/a
2 TRCN0000382222 GTGTCGTTCATTCGTACTATA pLKO_005 5543 CDS 100% 13.200 18.480 N MYO5A n/a
3 TRCN0000382038 AGGATAAGACGGTCCGTAAAC pLKO_005 4416 CDS 100% 10.800 15.120 N MYO5A n/a
4 TRCN0000059491 CGTACTATACAGATGCGTTTA pLKO.1 5555 CDS 100% 10.800 15.120 N MYO5A n/a
5 TRCN0000381168 CAACTGGAACTCGACCTTAAT pLKO_005 3272 CDS 100% 13.200 10.560 N MYO5A n/a
6 TRCN0000381587 ACGTGGTGTAGCAGTCAATTT pLKO_005 4642 CDS 100% 13.200 9.240 N MYO5A n/a
7 TRCN0000381304 TGCGCTGTATCAAGCCTAATG pLKO_005 2049 CDS 100% 10.800 7.560 N MYO5A n/a
8 TRCN0000059489 CGCTTTATTGATTCCAAACTT pLKO.1 350 CDS 100% 5.625 3.938 N MYO5A n/a
9 TRCN0000059492 CCAGTCAACATTCCCAGGAAA pLKO.1 4538 CDS 100% 4.950 3.465 N MYO5A n/a
10 TRCN0000059488 GCTCTCTAACACATGCCGATT pLKO.1 4822 CDS 100% 4.050 2.835 N MYO5A n/a
11 TRCN0000059490 CGGATTTGAAACATTTGAGAT pLKO.1 1393 CDS 100% 4.950 2.970 N MYO5A n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6777 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000154416 GAGGAAGGAAAGGAGGAGAAA pLKO.1 5989 3UTR 100% 4.950 2.475 Y GAS2L2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6778 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.