Transcript: Human XM_005254508.3

PREDICTED: Homo sapiens myotubularin related protein 10 (MTMR10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTMR10 (54893)
Length:
4851
CDS:
733..2322

Additional Resources:

NCBI RefSeq record:
XM_005254508.3
NBCI Gene record:
MTMR10 (54893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082695 GCTATGCGTTAATGAGCCTTT pLKO.1 1041 CDS 100% 4.050 5.670 N MTMR10 n/a
2 TRCN0000359559 AGTGATGCTGGATCCCTATTT pLKO_005 1242 CDS 100% 13.200 10.560 N MTMR10 n/a
3 TRCN0000359628 ATAAGACCTTGCCTAATATTC pLKO_005 986 CDS 100% 13.200 10.560 N MTMR10 n/a
4 TRCN0000359560 CAATTCGGAACCGAAGATTAA pLKO_005 154 5UTR 100% 13.200 9.240 N MTMR10 n/a
5 TRCN0000082696 CAGAGGATTTGTAATGCAATA pLKO.1 919 CDS 100% 10.800 7.560 N MTMR10 n/a
6 TRCN0000082694 CCAGAGGATTTGTAATGCAAT pLKO.1 918 CDS 100% 4.950 3.465 N MTMR10 n/a
7 TRCN0000081024 TCAGAGAAAGAGTCTCCTTTA pLKO.1 1354 CDS 100% 10.800 6.480 N Mtmr10 n/a
8 TRCN0000287853 TCAGAGAAAGAGTCTCCTTTA pLKO_005 1354 CDS 100% 10.800 6.480 N Mtmr10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.