Transcript: Human XM_005254713.5

PREDICTED: Homo sapiens talin 2 (TLN2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLN2 (83660)
Length:
12974
CDS:
1284..8957

Additional Resources:

NCBI RefSeq record:
XM_005254713.5
NBCI Gene record:
TLN2 (83660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254713.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439801 ACGATGCGTGTCGAGTCATTC pLKO_005 1366 CDS 100% 10.800 15.120 N TLN2 n/a
2 TRCN0000122990 CCATGTTAGAAGAGTCCGTTT pLKO.1 2545 CDS 100% 4.050 5.670 N TLN2 n/a
3 TRCN0000122989 CCTGGACCTCTTTATGATATT pLKO.1 9307 3UTR 100% 13.200 10.560 N TLN2 n/a
4 TRCN0000122993 GCCGAAATCGACATGGAGAAT pLKO.1 3828 CDS 100% 4.950 3.960 N TLN2 n/a
5 TRCN0000122991 CCAGAACCAAAGGGAACATTT pLKO.1 6816 CDS 100% 13.200 9.240 N TLN2 n/a
6 TRCN0000436291 GACGAATCCAAACACGAAATC pLKO_005 2901 CDS 100% 10.800 7.560 N TLN2 n/a
7 TRCN0000122992 CCATGCAGTTTGAACCATCTA pLKO.1 1336 CDS 100% 4.950 3.465 N TLN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254713.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.