Transcript: Human XM_005255210.2

PREDICTED: Homo sapiens C-type lectin domain containing 16A (CLEC16A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC16A (23274)
Length:
6827
CDS:
180..3335

Additional Resources:

NCBI RefSeq record:
XM_005255210.2
NBCI Gene record:
CLEC16A (23274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423539 TCTATGCCATGTCTCATAATA pLKO_005 1687 CDS 100% 15.000 21.000 N CLEC16A n/a
2 TRCN0000128719 CCTTATGTTTCCTTGAGCTAA pLKO.1 6608 3UTR 100% 4.950 6.930 N CLEC16A n/a
3 TRCN0000432057 GTCACGAGACCTCACTTTATT pLKO_005 505 CDS 100% 15.000 12.000 N CLEC16A n/a
4 TRCN0000130537 GCTAAGACTGAACAGGATATT pLKO.1 1212 CDS 100% 13.200 9.240 N CLEC16A n/a
5 TRCN0000413583 TGTTCACCTTGTACGACATTT pLKO_005 1961 CDS 100% 13.200 9.240 N CLEC16A n/a
6 TRCN0000130227 CAGCTCTGTATTTGACTTCTT pLKO.1 374 CDS 100% 4.950 3.465 N CLEC16A n/a
7 TRCN0000129302 CCTGAACATCACCATCCACAA pLKO.1 2480 CDS 100% 4.050 2.835 N CLEC16A n/a
8 TRCN0000130760 GCTGCTGATCTGAATATGGAA pLKO.1 4470 3UTR 100% 3.000 2.100 N CLEC16A n/a
9 TRCN0000184817 CCCAGTGCATAAACCAGCATA pLKO.1 2827 CDS 100% 4.950 2.970 N Clec16a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.