Transcript: Human XM_005256134.4

PREDICTED: Homo sapiens carbonic anhydrase 5A (CA5A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CA5A (763)
Length:
1393
CDS:
126..887

Additional Resources:

NCBI RefSeq record:
XM_005256134.4
NBCI Gene record:
CA5A (763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256134.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256134.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05921 pDONR223 100% 57.5% 33.4% None (many diffs) n/a
2 ccsbBroad304_05921 pLX_304 0% 57.5% 33.4% V5 (many diffs) n/a
3 TRCN0000481167 AAACCTCTTACATCTTATCGTATT pLX_317 45.4% 57.5% 33.4% V5 (many diffs) n/a
Download CSV