Transcript: Human XM_005256549.3

PREDICTED: Homo sapiens lysine demethylase 6B (KDM6B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM6B (23135)
Length:
6852
CDS:
529..5577

Additional Resources:

NCBI RefSeq record:
XM_005256549.3
NBCI Gene record:
KDM6B (23135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236677 AGTCCCACTCACCTCTATTTA pLKO_005 6143 3UTR 100% 15.000 21.000 N KDM6B n/a
2 TRCN0000360034 TCTGTACAGACCCTCGAAATC pLKO_005 4139 CDS 100% 10.800 15.120 N KDM6B n/a
3 TRCN0000095268 CCTCGTCATCTCAGTTCTCTA pLKO.1 3125 CDS 100% 4.950 3.960 N Kdm6b n/a
4 TRCN0000359976 GATCTCTATGCATCCAATATT pLKO_005 4855 CDS 100% 15.000 10.500 N KDM6B n/a
5 TRCN0000367906 GGAGACCTCGTGTGGATTAAT pLKO_005 4903 CDS 100% 15.000 10.500 N KDM6B n/a
6 TRCN0000236676 AGTGCGATGTGGAGGTGTTTA pLKO_005 5258 CDS 100% 13.200 9.240 N KDM6B n/a
7 TRCN0000236679 GCTCCGTCAACATCAACATTG pLKO_005 4718 CDS 100% 10.800 7.560 N KDM6B n/a
8 TRCN0000236678 TTGAGCACAAACGGAACTATG pLKO_005 1073 CDS 100% 10.800 7.560 N KDM6B n/a
9 TRCN0000359975 AGATTCTTTCTATGGGCTTTA pLKO_005 5995 3UTR 100% 10.800 6.480 N KDM6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.