Transcript: Human XM_005256563.4

PREDICTED: Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPRIP (23164)
Length:
15071
CDS:
299..7318

Additional Resources:

NCBI RefSeq record:
XM_005256563.4
NBCI Gene record:
MPRIP (23164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296941 ACGCAAGTGACAAGTACAAAG pLKO_005 7008 CDS 100% 10.800 15.120 N MPRIP n/a
2 TRCN0000048651 GCGACGGTTCTTCATCCTTTA pLKO.1 604 CDS 100% 10.800 15.120 N MPRIP n/a
3 TRCN0000048648 GCCTATGAACTAGAGGTCTTA pLKO.1 6896 CDS 100% 4.950 6.930 N MPRIP n/a
4 TRCN0000048649 GCCGACTTGGATGGAGAAATT pLKO.1 1673 CDS 100% 13.200 9.240 N MPRIP n/a
5 TRCN0000291591 GCCGACTTGGATGGAGAAATT pLKO_005 1673 CDS 100% 13.200 9.240 N MPRIP n/a
6 TRCN0000331106 AGAGGTCTTATTGCGGGTAAA pLKO_005 6907 CDS 100% 10.800 7.560 N MPRIP n/a
7 TRCN0000048652 CCAGAAGTTCTCCCTGTGTAT pLKO.1 736 CDS 100% 4.950 3.465 N MPRIP n/a
8 TRCN0000307723 CCAGAAGTTCTCCCTGTGTAT pLKO_005 736 CDS 100% 4.950 3.465 N MPRIP n/a
9 TRCN0000091177 GCCTGAGATACTACAGGGATT pLKO.1 1635 CDS 100% 4.050 2.835 N Mprip n/a
10 TRCN0000318286 GCCTGAGATACTACAGGGATT pLKO_005 1635 CDS 100% 4.050 2.835 N Mprip n/a
11 TRCN0000048650 GCTCTTTGAATCCAGGGACTT pLKO.1 7285 CDS 100% 4.050 2.835 N MPRIP n/a
12 TRCN0000307725 GCTCTTTGAATCCAGGGACTT pLKO_005 7285 CDS 100% 4.050 2.835 N MPRIP n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 11870 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 11870 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256563.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.