Transcript: Human XM_005256575.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 22 (USP22), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP22 (23326)
Length:
4931
CDS:
234..1496

Additional Resources:

NCBI RefSeq record:
XM_005256575.2
NBCI Gene record:
USP22 (23326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296869 CCTACCTGCTGTAAGATTATG pLKO_005 1859 3UTR 100% 13.200 18.480 N USP22 n/a
2 TRCN0000046923 CGGACTATACTGAGAGCCTAT pLKO.1 55 5UTR 100% 4.050 5.670 N USP22 n/a
3 TRCN0000046926 CGGCGGAAGATCACCACGTAT pLKO.1 1173 CDS 100% 1.650 2.310 N USP22 n/a
4 TRCN0000046927 GACAACAAGTATTCCCTGTTT pLKO.1 1296 CDS 100% 4.950 3.960 N USP22 n/a
5 TRCN0000296793 ACTGCAAAGGTGATGACAATG pLKO_005 748 CDS 100% 10.800 7.560 N USP22 n/a
6 TRCN0000296867 AGCTACCAGGAGTCCACAAAG pLKO_005 1080 CDS 100% 10.800 7.560 N USP22 n/a
7 TRCN0000296868 TGTGCCAGGACTACATCTATG pLKO_005 259 CDS 100% 10.800 7.560 N USP22 n/a
8 TRCN0000046925 CGAAGGGTACTTGCTGTTCTA pLKO.1 1448 CDS 100% 4.950 3.465 N USP22 n/a
9 TRCN0000291124 CGAAGGGTACTTGCTGTTCTA pLKO_005 1448 CDS 100% 4.950 3.465 N USP22 n/a
10 TRCN0000046924 GCTGTTTCACAAAGAAGCATA pLKO.1 166 5UTR 100% 4.950 3.465 N USP22 n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3584 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256575.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11719 pDONR223 100% 81.8% 81.8% None 0_1ins279;6C>T n/a
2 ccsbBroad304_11719 pLX_304 0% 81.8% 81.8% V5 0_1ins279;6C>T n/a
3 TRCN0000476125 ACGTTGCGGTGATGGCGGGCGTTC pLX_317 19.5% 81.8% 81.8% V5 0_1ins279;6C>T n/a
Download CSV