Transcript: Human XM_005257160.2

PREDICTED: Homo sapiens bromodomain PHD finger transcription factor (BPTF), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BPTF (2186)
Length:
11182
CDS:
209..9094

Additional Resources:

NCBI RefSeq record:
XM_005257160.2
NBCI Gene record:
BPTF (2186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016819 GCGGCAGCTAATGAAGAAATT pLKO.1 1856 CDS 100% 13.200 9.240 N BPTF n/a
2 TRCN0000319152 GCGGCAGCTAATGAAGAAATT pLKO_005 1856 CDS 100% 13.200 9.240 N BPTF n/a
3 TRCN0000016822 CCAGTAGAGAACAAGATCAAA pLKO.1 1274 CDS 100% 5.625 3.938 N BPTF n/a
4 TRCN0000319225 CCAGTAGAGAACAAGATCAAA pLKO_005 1274 CDS 100% 5.625 3.938 N BPTF n/a
5 TRCN0000016821 GCCAGGCAATACTAATGTGAA pLKO.1 3355 CDS 100% 4.950 3.465 N BPTF n/a
6 TRCN0000319153 GCCAGGCAATACTAATGTGAA pLKO_005 3355 CDS 100% 4.950 3.465 N BPTF n/a
7 TRCN0000016818 CGCCACTAACAGAGAAGGATT pLKO.1 8730 CDS 100% 4.950 2.970 N BPTF n/a
8 TRCN0000319154 CGCCACTAACAGAGAAGGATT pLKO_005 8730 CDS 100% 4.950 2.970 N BPTF n/a
9 TRCN0000238662 GACGACGATGACTCCGATTAT pLKO_005 713 CDS 100% 13.200 6.600 Y Bptf n/a
10 TRCN0000016820 CGCCTTATGATGAATCTAAAT pLKO.1 8400 CDS 100% 13.200 18.480 N BPTF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257160.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.